1. What aspects of the letter’s argument are most convincing? How could they be improved or expanded in the paper?

2. What aspects of the letter’s argument (what parts) are least convincing?

3. Do you feel the letter is lacking any discussion, issues or topics we discussed in class?

4. Having heard my clarification of the need for specific evidence in terms of course work, faculty and other relevant and interesting academic evidence or experience, does the writer seem to have done enough work on this specialized and even technical research and writing? This really concerns the “authority” of the writer. Has he or she established a knowledgeable persona, one who can speak to the richness of the experience in this major and discipline?

5. How are the transitions between sections/topics/arguments/paragraphs? Provide a little feedback on the flow of the letter.

6. How would you evaluate the writer’s use of outside sources? Do you sense a need for more specific references? Do you sense any “accidental” plagiarism (need for citation)?

7. Do you see some obvious sentence-level errors, such as run-on sentences, fragments, or simply sentences (parts of paragraphs) that don’t seem very clear or concise? Sometimes simply pointing-out that the writing is confusing, or wordy is enough to get the writer to review some of his/her writing.

8. Do the paragraphs seem to have a solid focus and structure? Again, make a note on this part of the writing, reflecting on some of our discussion in class.

9. Is there a sense of ethos not only in the writer (knowledge, experience, passion and values), but also in the work done in that major or field/discipline? Ethos should emanate from the writer and, in this case, his or her major/department, as well.

10. Do you have any feedback on the paper format? In the end, this is a 4-5 page paper, not including the Works Cited page, double-spaced (pretty much in MLA format). Do they seem on track to write a paper that addresses the prompt in 4-5 pages? Anything else about the format?

Spec Sheets – critical importance items/ avionics / mods/ upgrades/ layouts/ print and digital

select a type of plane in that category and find a specific SN plane with some photos, design a spec sheet for that specific plane, the information included in that spec sheet should be accurate including the equipment and avionics list and basic performance characteristics.

The coursework assignment contains three sections. (I included the actual assigment as the first attachment, the second attachment is just to help you do harvard style citations, and the third attachment is the formulas to help solve the problems) You also will need SPSS for third section :)

The first section deals with measures of central tendency and dispersion, the standard normal distribution and z-scores, and Pearson’s correlation coefficient.

Section 2 covers Ordinary Least Squares regression. For both sections, you should calculate the solutions step-by-step and show your calculations clearly using structured tables as per the tutorials and lectures.

In section 3 you are asked to research a question using multiple regression analysis performed via SPSS and to write up your results and conclusions.

Please make sure that you cite ALL the sources you’ve used and include them all in your bibliography using the Harvard style. Please read the guidance on plagiarism and how to avoid it and make sure your assignment does not contain any plagiarism. Direct quotations must be placed in quotation marks and the source (author, year of publication, and page number) included in the text. If you paraphrase from a sentence from another source you must cite the source (author, year of publication and page number) at the end of each sentence that contains the paraphrased text.

Thesis Statement, Outline, & Annotated Bibliography paper. The student will write a research paper in current APA format discussing and evaluating the current research in the field of false memories. The paper must have a reference page of at least 12 peer-reviewed journal articles.

Complete all 39 questions in Exercise 6A in the PDF ‘Chapter 6: Fallacious Arguments’. Make sure that you follow the instructions carefully – identify each fallacy by name and also justify your responses. In other words, explain why you think each one is the particular fallacy that you have selected.

Exercise 6A is on page 10 of the PDF, or page 139 of the text inside the PDF.

Following the seven steps of EBP you will evaluate evidence and develop/add to guidelines so we can apply the evidence to practice. You will go through these steps as we have practiced during practical, for two disorders: migraine (Assignment 2). Assignment 2 each consist of the same steps. Both have a written part and a verbal examination (presentation).

For Assignment 2, you will receive one piece of evidence with your group that you will analyse on strength. In order to analyse the evidence we can use PICO and have a review of both the source and the level of the evidence.

In your written assignment 2, please answer the following questions:

• Background of the study

• PICO

• Rapic Critical Appraisal method. (Appendix 1 and 2)

• Brief explanation of each disorder

• Prevalence of disorder

• Sample/design

• Rationale (the importance of the study/why do we need to conduct this study)

Can you identify the

• Problem/ population/ patient – Intervention

• Control group

• Outcome?

“Rapid Critical Appraisal” involves three questions used to evaluate the usefulness of the study you are considering:

A). Are the results of the study valid? Are the research methods rigourous enough to ensure that the results properly represent the truth of the matter?

• Random assignment to control/ treatment groups?

• Characteristics of groups?

• Validity and reliability of outcome measures?

B. What are the results and are they important?

• In interventions did it work? Impact on outcomes?

• Replicability for other clinicians?

• Are the subjects and participants in the study similar to your own patients?

• Do the benefits of the intervention outweigh any risks?

• How feasible and cost effective would it be to carry out the same intervention?

• Consider how your patients preferences and values fit with this style of intervention.

C. Will the results help me care for my patients?

Write a report on your selected piece of evidence answering the questions in appendix 1 and/or 2. Some questions in the appendix might not be applicable to your article, if not, explain why not.

• Amount of words: 800

• Font size: Times New Roman 12pt

https://bergen.webex.com/webappng/sites/bergen/rec.. Hi, please watch the videos. This is LAB REPORT FOLDER.I also uploaded my class video, so the prof already gave every detail. Thank youPlease follow the below format for this experiment

1 – Title Page

2 – Introduction

3 – Equipment/Materials

4 – Results (you can include observations)

5 – Pre- Lab

6 – Post Lab

1. (From Lehninger Principles, 6th ed., p. 309 #2) One strand of a double-helical DNA has the sequence (5’) GCGCAATATTTCTCAAAATATTGCGC (3’).
A. Write the base sequence of the complementary strand below the sequence of the given strand.
B. What special type of sequence is contained in this DNA segment?
C. Does the double-stranded DNA have the potential to form any alternative structures?
2. Restriction-modification systems are important components of prokaryotic defense mechanisms against foreign genetic material. They comprise of two distinct enzymatic activities: a restriction endonuclease and a methyltransferase.
The restriction endonuclease recognizes and cleaves foreign DNA sequences at specific sites, while mehtyltransferase transfers methyl groups to the same specific DNA sequence to the C-5 carbon or the N4 amino group of cytosine or to the N6 amino group of adenine.
What is the purpose of the methyl-transfer reaction? How is the purpose accomplished?
3. Two complementary strands of DNA can exist in solution in the form of a duplex (double-stranded form) or can exist as separate strands (“random coils”), depending on the position of the equilibrium shown below.
Double-stranded form < = = > single strands (“random coil”)
A. In the table below, for the process of strand separation (the direction written above), list and explain 2 different types of interactions that contribute to the H; and list and explain 2 different types of interactions that contribute to the S for the duplex-random coil transition. For each contribution to H and for each contribution to S, state whether that thermodynamic contribution favors the
double-stranded or the single-stranded form of DNA.

DETAILED ASSIGNMENT

20210313054331discussion_8_w21_practiceproblems_nucleic_acids_and_dna_protein_interaction

Thesis Statement, Outline, & Annotated Bibliography paper. The student will write a research paper in current APA format discussing and evaluating the current research in the field of false memories. The paper must have a reference page of at least 12 peer-reviewed journal articles.

The Curious Case of Phineas Gage

Look back in your text to p. 64 and visit the following websites to read the details of the case of Phineas Gage:

• http://news.harvard.edu/gazette/story/2015/10/lessons-of-the-brain-the-phineas-gage-story/

• https://en.wikipedia.org/wiki/Phineas_Gage

After exploring this case and the specific brain damage that he experienced, write a 1-2 page paper discuss the following:

• How his personality and emotional makeup changed after the accident.

• How can these changes be explained biologically based on the part of the brain that was damaged?

• What valuable insights were gained in the field of Behavioral Neuroscience from the study and life of Gage?